Follow Us


Question 3

If the sequence of one strand of DNA is written as follows:
5-ATGCATGCATGCATGCATGCATGCATGC-3
Write down the sequence of complementary strand in 5→3 direction

Answer

The DNA strands are complementary to each other with respect to base sequence. Hence, if the sequence of one strand of DNA is

5'- ATGCATGCATGCATGCATGCATGCATGC − 3’

Then, the sequence of complementary strand in direction will be

3'- TACGTACGTACGTACGTACGTACGTACG − 5’

Therefore, the sequence of nucleotides on DNA polypeptide in direction is

5'- GCATGCATGCATGCATGCATGCATGCAT− 3’

Write a Comment:

-->