If the sequence of one strand of DNA is written as follows:
5-ATGCATGCATGCATGCATGCATGCATGC-3
Write down the sequence of complementary strand in 5→3 direction
The DNA strands are complementary to each other with respect to base sequence. Hence, if the sequence of one strand of DNA is
5'- ATGCATGCATGCATGCATGCATGCATGC − 3’
Then, the sequence of complementary strand in direction will be
3'- TACGTACGTACGTACGTACGTACGTACG − 5’
Therefore, the sequence of nucleotides on DNA polypeptide in direction is
5'- GCATGCATGCATGCATGCATGCATGCAT− 3’
Popular Questions of Class 12 Biology
- Q:- What is spermatogenesis? Briefly describe the process of spermatogenesis.
- Q:- Why is reproduction essential for organisms? Answer
- Q:- Write a short note on
(a) Adaptations of desert plants and animals
(b) Adaptations of plants to water scarcity
(c) Behavioural adaptations in animals
(d) Importance of light to plants
(e) Effect of temperature or water scarcity and the adaptations of animals. - Q:- With a neat diagram explain the 7-celled, 8-nucleate nature of the female gametophyte.
- Q:- What is DNA fingerprinting? Mention its application.
- Q:- What is oogenesis? Give a brief account of oogenesis.
- Q:- Describe the structure of a seminiferous tubule.
- Q:- What is triple fusion? Where and how does it take place? Name the nuclei involved in triple fusion.
- Q:- With a neat, labelled diagram, describe the parts of a typical angiosperm ovule.
- Q:- Explain the Law of Dominance using a monohybrid cross.
Recently Viewed Questions of Class 12 Biology
- Q:- When a cross in made between tall plants with yellow seeds (Ttyy) and tall plant with green seed (Ttyy), what proportions of phenotype in the offspring could be expected to be (a) Tall and green. (b) Dwarf and green.
- Q:- What is the major advantage of producing plants by micropropagation?
- Q:- Three water samples namely river water, untreated sewage water and secondary effluent discharged from a sewage treatment plant were subjected to BOD test. The samples were labelled A, B and C; but the laboratory attendant did not note which was which. The BOD values of the three samples A, B and C were recorded as 20mg/L, 8mg/L and 400mg/L, respectively. Which sample of the water is most polluted? Can you assign the correct label to each assuming the river water is relatively clean?
- Q:- Give an example for:
(a) An endothermic animal
(b) An ectothermic animal
(c) An organism of benthic zone - Q:-
Fill in the blanks:
(a) Humans reproduce __________. (asexually/sexually)
(b) Humans are__________. (oviparous/viviparous/ovoviviparous)
(c) Fertilization is __________ in humans. (external/internal)
(d) Male and female gametes are __________. (diploid/haploid)
(e) Zygote is __________. (diploid/haploid)
(f) The process of release of the ovum from a mature follicle is called__________.
(g) Ovulation is induced by a hormone called the __________.
(h) The fusion of male and female gametes is called _____________.
(i) Fertilisation takes place in _____________.
(j) Zygote divides to form _____________which is implanted in uterus.
(k) The structure which provides vascular connection between fetus and uterus is called ____________. - Q:- What is primary productivity? Give brief description of factors that affect primary productivity.
- Q:- What are sacred groves? What is their role in conservation?
- Q:- Compare and contrast the advantages and disadvantages of production of genetically modified crops.
- Q:- Why is apple called a false fruit? Which part(s) of the flower forms the fruit?
- Q:- Collect 5 examples of palindromic DNA sequences by consulting your teacher. Better try to create a palindromic sequence by following base-pair rules.
- NCERT Chapter