The DNA strands are complementary to each other with respect to base sequence. Hence, if the sequence of one strand of DNA is
5'- ATGCATGCATGCATGCATGCATGCATGC − 3’
Then, the sequence of complementary strand in direction will be
3'- TACGTACGTACGTACGTACGTACGTACG − 5’
Therefore, the sequence of nucleotides on DNA polypeptide in direction is
5'- GCATGCATGCATGCATGCATGCATGCAT− 3’
Why is the Human Genome project called a mega project?
Fill in the blanks:
(a) Humans reproduce __________. (asexually/sexually)
(b) Humans are__________. (oviparous/viviparous/ovoviviparous)
(c) Fertilization is __________ in humans. (external/internal)
(d) Male and female gametes are __________. (diploid/haploid)
(e) Zygote is __________. (diploid/haploid)
(f) The process of release of the ovum from a mature follicle is called__________.
(g) Ovulation is induced by a hormone called the __________.
(h) The fusion of male and female gametes is called _____________.
(i) Fertilisation takes place in _____________.
(j) Zygote divides to form _____________which is implanted in uterus.
(k) The structure which provides vascular connection between fetus and uterus is called ____________.
Fill in the blanks:
(a) Humans reproduce __________. (asexually/sexually)
(b) Humans are__________. (oviparous/viviparous/ovoviviparous)
(c) Fertilization is __________ in humans. (external/internal)
(d) Male and female gametes are __________. (diploid/haploid)
(e) Zygote is __________. (diploid/haploid)
(f) The process of release of the ovum from a mature follicle is called__________.
(g) Ovulation is induced by a hormone called the __________.
(h) The fusion of male and female gametes is called _____________.
(i) Fertilisation takes place in _____________.
(j) Zygote divides to form _____________which is implanted in uterus.
(k) The structure which provides vascular connection between fetus and uterus is called ____________.