Molecular Basis of Inheritance Question Answers: NCERT Class 12 Biology

Current NCERT chapter
Academic session 2026-27
2 Solutions · 0 Topics · 0 Notes resources

This chapter is part of the verified current curriculum mapping for the academic session shown below.

Chapter Details

Chapter
5 — Molecular Basis of Inheritance
NCERT Book
Biology
Language
English
Edition
Academic session 2026-27

Use this Class 12 Biology chapter hub to study Molecular Basis of Inheritance from one place. SaralStudy currently provides 2 visible NCERT solution entries on this page.

NCERT Solutions

Review the SaralStudy solution entries currently available for this chapter.

Exercise 0
A:

Histones are the basic proteins that binds the DNA to form the eukaryotic chromosome. They are responsible for the chromosome organization called the nucleosome. Nucleosomes (provides the first level of DNA packing) contains histone octamer which contains two copies of each histone type. Histones are rich in arginine and lysine; and contains positive charge that neutralize the negatively charged DNA helix.  


A:

The process of making identical or same copies of dsDNA (double stranded DNA) by using template DNA or existing DNA for the synthesis of new strand is known as DNA replication. Many enzymes and proteins are involved in this process:

  1. DNA helicase and primase: These are the two enzymes that enables the polymerase to work on a duplex DNA. DNA helicase opens the duplex helix at the replication fork which provides single strand as an template. Primase synthesizes a short RNA primers which leads to DNA chain elongation.
  2. Topoisomerase: These are required to relieve or for the removal of positive supercoiling of DNA which arises by the DNA unwinding and DNA gyrase has that ability to remove that supercoiling and introduces negative supercoiling to the DNA.   

A:

In some viruses, RNA is the genetic material. Example: TMV, Bacteriophage, HIV, Influenza virus etc.  


A:

Some amino acids are coded by more than one codon which is known as degeneracy of codons. Hence, on deducing a nucleotide sequence from an amino acid sequence, multiples nucleotide sequence will be obtained, example; Ile (isoleucine) has three codons AUU, AUC, AUA. Hence, a dipeptide Met- Ile can have the following nucleotide sequences.

  1. AUG-AUU
  2. AUG-AUC
  3. AUG-AUA

And if, we deduce amino sequence from the above nucleotide sequences then all the three sequences will code for Methionine and Isoleucine.


A:

The statement is correct. Because of degeneracy of codons, mutation at third base of codon, usually does not result into any change is phenotype. This is called silent mutations.

On the other hand, if codon is changed in any way that now it specifies another amino acid, it may do other protein functions as it happens in case of β- globulin of haemoglobin protein. Whereas substitution of valine instead of glutamic acid causes change in its structure and function and resulting into sickle cell trait.  


A:

In complete absence of expression of lac operon, permease will not be synthesized which is essential for the transport of lactose from medium into the cells. And, lactose acts as inducer when it cannot be transported into the cell. Hence, cannot relieve the lac operon from its repressed state.   


A:

The sequencing of human genome in enhancing the basic understanding of genetics and immunity to various disorders. Various genes that cause genetic disorders were identified with the help of this project. It was found that more than 1200 genes are responsible for common human cardiovascular diseases, endocrine diseases, neurological disorders and cancers and many more. These diseases can be treated easily by knowing the particular gene mutation that is responsible for the particular disease.


A:

The total number of genes is estimated at 25000 much lower than previous estimates of 140000 that had based on extrapolation from gene- rich areas as opposed to a composite of gene rich and gene poor areas.

Almost all 99.9% nucleotide bases are exactly the same in all people. Functions for over 50% discovered genes are not known yet. Scientists have identified about 1.4 million locations where single base DNA difference occur in humans. This information provides to revolutionize the processes of finding chromosomal locations which is for disease associated sequence and tracing human history.    


A:

Human genome helps to find out the complete genome sequence of the human. It has many advantages and disadvantages.

Some important advantages:

It enhances the basic understanding of human genetics. Reveals the genes responsible for diseases such as cardiovascular ailments, Alzheimer’s diseases, cancer etc. Provides information that will help in the prevention of inherited diseases, Leads to the treatment of genetic disorders through gene therapy etc. are the advantages.

Some important disadvantages:

People might discover and untreatable genetic disease. People may not take serious about the knowledge obtained from the HGP. Problem can occur for the ownership of the genetic test result or from mutation and the patenting of human genes and DNA.  


A:

Bacteriophage does not contains repetitive sequences like Variable Number Tandem Repeats (VNTRs) in its genome, as its genome is very small and have all the coding sequence. DNA finger printing is not applied for phages.


A:

Further Polymerization would not occur, as the 3’OH on sugar is not there to add a new nucleotide for forming ester bond.


A:

Chromatin is an organized structure of DNA and proteins which is found in the nucleus of the eukaryotic cells. Differences between euchromatin and heterochromatin (they both are the parts of chromatin) are as follows:

Euchromatin

Heterochromatin

The light staining portion of chromatin is known as euchromatin.

The dark staining portion of the chromatin is known as heterochromatin.

These are less condensed.

These are highly condensed.

They are transcriptionally active and contains maximum protein coding genes.

They are transcriptionally inactive or silent because of the condensed state at the Interphase.

 


A:

Watson and Crick had the following information which helped them to develop a model of DNA.

  1. Chargaff’s law suggesting A= T and C= G
  2. Wilkins and Rosalind Franklin’s work on DNA crystal’s X- ray diffraction studies about DNA physical structure.

Watson and Crick proposed

  1. Pattern of complementary base pairs
  2. Semi- conservative replication
  3. Mutation through tautomerism

A:
  1. Methylated guanine cap helps in binding of mRNA to smaller ribosomal sub-unit in the initiation of translation.
  2. Poly- A tail provides longevity to mRNA's life. Tail length and longevity of mRNA are positively correlated.   

A:

Functional mRNA of structural genes need not always include all of its exons. This alternate splicing of exons of sex- specific, tissue specific and even developmental stage- specific. By such alternate splicing of exons, a single gene may encode for several isoproteins.

In the absence of such kind of splicing, there should have been new variety of genes for every protein/ isoprotein. This extravagancy has and should been avoided in natural phenomena by way of alternate splicing.   


A:

Tandemness in repeats provides many copies of the sequence for finger- printing and variability in nitrogen base sequences present in them. Being individual specific, this proves to be useful in the process of DNA fingerprinting.  


A:

DNA polymerase catalyzes the synthesis of DNA or helps in the DNA replication. There are different types of DNA polymerase in E.coli with different functions. DNA polymerase enzyme synthesize new polynucleotides that is complementary to an existing or template DNA strand and it also have DNA proofreading capability. DNA proofreading involves the scanning of errors in DNA chains and correcting the chain extension before the continuation. This process is carried out by 3’ to 5’ exonuclease activity which is built into DNA polymerase. This shows the dual nature.  


A:

Synthesis of DNA always takes place in 5’ to 3’ direction. In a dsDNA both strands are anti parallel and complementary. During DNA synthesis as both strands acts as templates, only one strand, i.e., 3’ to 5’ can synthesis complementary strand in 5’ to 3’ direction.

The other strand, i.e., 5’ to 3’ has to be synthesized in small stretches in opposite direction as replication fork moves to right. That is why DNA synthesis is discontinuous on one of the parental strands of DNA. These small stretches called Okazaki fragments are joined together by DNA ligase enzyme that closes the nicks which is also known as lagging strand.  


A:

According to base complementary rules,

  1. 5’TTACGTCGATAATCC-3’
  2. 5’ CGAUUAUCGACGUAA-3’

RNA uses the base uracil (U) instead of using thymine (T). So, in RNA the base pairs are Adenine (A) pairs with uracil (U); Guanine (G) pairs with cytosine (C).   


A:

DNA polymorphism is defined as the variation in DNA sequences arising through mutation at non- coding sequences.

A special type of polymorphism known as VNTR (variable number of tandem repeats) which is composed of repeated copies of a DNA sequence that lie adjacent to one another on the chromosome. Since, polymorphism is the basis of genetic mapping of human genome. And, it forms the basis of DNA fingerprinting technique. The single nucleotide polymorphism is being used in finding the diseases and tracing of human history as well as in case of paternity testing.  


A:

Due to point mutation in β- globin chain of haemoglobin molecules, glutamic acid (Glu) is replaced by valine (Val) at the sixth position. Under the stress or tensioned condition erythrocytes lose their circular shape or we can say its original shape and become sickle- shaped. As a result, the cells cannot lead through narrow capillaries. Blood capillaries gets clogged and thus this affects blood supply to different organs.  


A:

Sometimes cattle or even human beings give birth to their young ones which contains very different types of organs such as limbs, position of eye etc. It happens because of the disturbance in coordinated regulation of expression in sets of genes that are associated with organ development.  


A:

DNA polymerase enzyme is highly specific to recognize only deoxyribonucleoside triphosphates, therefore, it cannot hold RNA β- nucleotides.


Exercise 1
A:

Nitrogenous bases present in the list are adenine, thymine, uracil, and cytosine.

Nucleosides present in the list are cytidine and guanosine.


A:

Lac operon is a segment of DNA that is made up of three adjacent structural genes, namely, an operator gene, a promoter gene, and a regulator gene. It works in a coordinated manner to metabolize lactose into glucose and galactose.

In lac operon, lactose acts as an inducer. It binds to the repressor and inactivates it. Once the lactose binds to the repressor, RNA polymerase binds to the promoter region. Hence, three structural genes express their product and respective enzymes are produced. These enzymes act on lactose so that lactose is metabolized into glucose and galactose.

After sometime, when the level of inducer decreases as it is completely metabolized by enzymes, it causes synthesis of the repressor from regulator gene. The repressor binds to the operator gene and prevents RNA polymerase from transcribing the operon. Hence, the transcription is stopped. This type of regulation is known as negative regulation.

Negative Regulation


A:

(a) Promoter

Promoter is a region of DNA that helps in initiating the process of transcription. It serves as the binding site for RNA polymerase.

(b) tRNA

tRNA or transfer RNA is a small RNA that reads the genetic code present on mRNA. It carries specific amino acid to mRNA on ribosome during translation of proteins.

(c) Exons

Exons are coding sequences of DNA in eukaryotes that transcribe for proteins.


A:

Human genome project was considered to be a mega project because it had a specific goal to sequence every base pair present in the human genome. It took around 13 years for its completion and got accomplished in year 2003. It was a large scale project, which aimed at developing new technology and generating new information in the field of genomic studies. As a result of it, several new areas and avenues have opened up in the field of genetics, biotechnology, and medical sciences. It provided clues regarding the understanding of human biology.


A:

DNA fingerprinting is a technique used to identify and analyze the variations in various individuals at the level of DNA. It is based on variability and polymorphism in DNA sequences.

Application

(1) It is used in forensic science to identify potential crime suspects.

(2) It is used to establish paternity and family relationships.

(3) It is used to identify and protect the commercial varieties of crops and livestock.

(4) It is used to find out the evolutionary history of an organism and trace out the linkages between groups of various organisms.


A:

(a) Transcription

Transcription is the process of synthesis of RNA from DNA template. A segment of DNA gets copied into mRNA during the process. The process of transcription starts at the promoter region of the template DNA and terminates at the terminator region. The segment of DNA between these two regions is known as transcription unit. The transcription requires RNA polymerase enzyme, a DNA template, four types of ribonucleotides, and certain cofactors such as Mg2+.

The three important events that occur during the process of transcription are as follows.

(i) Initiation

(ii) Elongation

(iii) Termination

The DNA-dependent RNA polymerase and certain initiation factors (σ) bind at the double stranded DNA at the promoter region of the template strand and initiate the process of transcription. RNA polymerase moves along the DNA and leads to the unwinding of DNA duplex into two separate strands. Then, one of the strands, called sense strand, acts as template for mRNA synthesis. The enzyme, RNA polymerase, utilizes nucleoside triphosphates (dNTPs) as raw material and polymerizes them to form mRNA according to the complementary bases present on the template DNA. This process of opening of helix and elongation of polynucleotide chain continues until the enzyme reaches the terminator region. As RNA polymerase reaches the terminator region, the newly synthesized mRNA transcripted along with enzyme is released. Another factor called terminator factor (ρ) is required for the termination of the transcription.

Process of transcription

(b) Polymorphism

Polymorphism is a form of genetic variation in which distinct nucleotide sequence can exist at different sites in a DNA molecule. This heritable mutation is observed at a high frequency in a population. It arises due to mutation either in somatic cell or in the germ cells. The germ cell mutation can be transmitted from parents to their offsprings. This results in accumulation of various mutations in a population, leading to variation and polymorphism in the population. This plays a very important role in the process of evolution and speciation.

(c) Translation

Translation is the process of polymerizing amino acid to form a polypeptide chain a ribosome by reading mRNA molecule. The triplet sequence of base pairs in mRNA defines the order and sequence of amino acids in a polypeptide chain.

The process of translation involves three steps.

(i) Initiation

(ii) Elongation

(iii) Termination

During the initiation of the translation, tRNA gets charged when the amino acid binds to it using ATP. The start (initiation) codon (AUG) present on mRNA is recognized only by the charged tRNA. The ribosome acts as an actual site for the process of translation and contains two separate sites in a large subunit for the attachment of subsequent amino acids. The small subunit of ribosome binds to mRNA at the initiation codon (AUG) followed by the large subunit. Then, it initiates the process of translation. During the elongation process, the ribosome moves one codon downstream along with mRNA so as to leave the space for binding of another charged tRNA. The amino acid brought by tRNA gets linked with the previous amino acid through a peptide bond and this process continues resulting in the formation of a polypeptide chain. When the ribosome reaches one or more STOP codon (UAA, UAG, and UGA), the process of translation gets terminated. The polypeptide chain is released and the ribosomes get detached from mRNA.

Translation Of Proteins

(d) Bioinformatics

Bioinformatics is the application of computational and statistical techniques to the field of molecular biology. It solves the practical problems arising from the management and analysis of biological data. The field of bioinformatics developed after the completion of human genome project (HGP). This is because enormous amount of data has been generated during the process of HGP that has to be managed and stored for easy access and interpretation for future use by various scientists. Hence, bioinformatics involves the creation of biological databases that store the vast information of biology.

It develops certain tools for easy and efficient access to the information and its utilization. Bioinformatics has developed new algorithms and statistical methods to find out the relationship between the data, to predict protein structure and their functions, and to cluster the protein sequences into their related families.


A:

According to Chargaff’s rule, the DNA molecule should have an equal ratio of pyrimidine (cytosine and thymine) and purine (adenine and guanine). It means that the number of adenine molecules is equal to thymine molecules and the number of guanine molecules is equal to cytosine molecules.

% A = % T and % G = % C

If dsDNA has 20% of cytosine, then according to the law, it would have 20% of guanine.

Thus, percentage of G + C content = 40%

The remaining 60% represents both A + T molecule. Since adenine and guanine are always present in equal numbers, the percentage of adenine molecule is 30%.


A:

The DNA strands are complementary to each other with respect to base sequence. Hence, if the sequence of one strand of DNA is

5'- ATGCATGCATGCATGCATGCATGCATGC − 3’

Then, the sequence of complementary strand in direction will be

3'- TACGTACGTACGTACGTACGTACGTACG − 5’

Therefore, the sequence of nucleotides on DNA polypeptide in direction is

5'- GCATGCATGCATGCATGCATGCATGCAT− 3’


A:

If the coding strand in a transcription unit is

5’− ATGCATGCATGCATGCATGCATGCATGC-3’

Then, it is known that the sequence of mRNA is same as the coding strand of DNA.

However, in RNA, thymine is replaced by uracil.

Hence, the sequence of mRNA will be

5’ − AUGCAUGCAUGCAUGCAUGCAUGCAUGC-3’


A:

Watson and Crick observed that the two strands of DNA are anti-parallel and complementary to each other with respect to their base sequences. This type of arrangement in DNA molecule led to the hypothesis that DNA replication is semi-conservative. It means that the double stranded DNA molecule separates and then, each of the separated strand acts as a template for the synthesis of a new complementary strand. As a result, each daughter DNA molecule would have one parental strand and a newly synthesized daughter strand.

Since only one parental strand is conserved in each daughter molecule, it is known as semi-conservative mode of replication.

Parental  and Daughter Strand


A:

There are two different types of nucleic acid polymerases.

(1) DNA-dependent DNA polymerases

(2) DNA-dependent RNA polymerases

The DNA-dependent DNA polymerases use a DNA template for synthesizing a new strand of DNA, whereas DNA-dependent RNA polymerases use a DNA template strand for synthesizing RNA.


A:

Hershey and Chase worked with bacteriophage and E.coli to prove that DNA is the genetic material. They used different radioactive isotopes to label DNA and protein coat of the bacteriophage.

They grew some bacteriophages on a medium containing radioactive phosphorus (32P) to identify DNA and some on a medium containing radioactive sulphur (35S) to identify protein. Then, these radioactive labelled phages were allowed to infect E.coli bacteria. After infecting, the protein coat of the bacteriophage was separated from the bacterial cell by blending and then subjected to the process of centrifugation.

Since the protein coat was lighter, it was found in the supernatant while the infected bacteria got settled at the bottom of the centrifuge tube. In case I, supematatn was found radioactive. Which shows protein did not enter in bacterial cell during infection. While in case II, Bacterial cells in pelld were radioactive as they have radioactive DNA.

Hence, it was proved that DNA is the genetic material as it was transferred from virus to bacteria.

Hershey and Chase experiment


A:

(a) Repetitive DNA and satellite DNA

Repetitive DNA

Satellite DNA

1.

Repetitive DNA are DNA sequences that contain small segments, which are repeated many times.

Satellite DNA are DNA sequences that contain highly repetitive DNA.

     

(b) mRNA and tRNA

mRNA

tRNA

1.

mRNA or messenger RNA acts as a template for the process of transcription.

tRNA or transfer RNA acts as an adaptor molecule that carries a specific amino acid to mRNA for the synthesis of polypeptide.

2.

It is a linear molecule.

It has clover leaf shape.

(c) Template strand and coding strand

Template strand

Coding strand

1.

Template strand of DNA acts as a template for the synthesis of mRNA during transcription.

Coding strand is a sequence of DNA that has the same base sequence as that of mRNA (except thymine that is replaced by uracil in DNA).

2.

It runs from 3’ to 5’.

It runs from 5’to 3’.

 


A:

The important functions of ribosome during translation are as follows.

(a) Ribosome acts as the site where protein synthesis takes place from individual amino acids. It is made up of two subunits.

The smaller subunit comes in contact with mRNA and forms a protein synthesizing complex whereas the larger subunit acts as an amino acid binding site.

(b) Ribosome acts as a catalyst for forming peptide bond. For example, 23s r-RNA in bacteria acts as a ribozyme.


NCERT Textbook PDF

Use the available NCERT textbook PDF alongside the chapter solutions.

NCERT Exemplar

Use the mapped NCERT Exemplar resource for additional chapter practice.

Current Exemplar

Removed / Changed Chapters from the Syllabus

Current and historical curriculum records are shown separately so removed material is not mixed into current practice.

Previous / Removed Chapters

  • Chapter 1: Reproduction in Organisms (rationalised)
  • Chapter 9: Strategies for Enhancement in Food Production (rationalised)
  • Chapter 16: Environmental Issues (rationalised)

Frequently Asked Questions about Molecular Basis of Inheritance - Class 12 Biology

    • 1. Is Molecular Basis of Inheritance in the current curriculum?
    • This chapter is part of the verified current curriculum mapping for the academic session shown below. Verified academic session: 2026-27.
    • 2. How many NCERT solution entries are currently available for Molecular Basis of Inheritance?
    • SaralStudy currently shows 2 visible solution entries on this chapter page.
    • 3. Are topic mappings available for Molecular Basis of Inheritance?
    • No public topic mappings are currently available for this chapter.
    • 4. Are revision notes available for Molecular Basis of Inheritance?
    • No verified chapter notes are currently available in this hub.

Latest Blog Posts

Stay updated with our latest educational content and study tips

Business After 30 or a Stable Job: Which Path Should You Choose?

Thirty is when the question starts to get raised and you’re able to do something because you know you have the experience—you know you have the responsibility. Here are some ways to consider the choice based on a realistic assessment without idealizing either aspect. Restlessness is one of those things that appears in your early … Read more

Read More

How to Return to Work After a Career Break: Skills, Jobs and Preparation in 2026

It’s not about starting over if you took a break to care for children, take care of yourself, be healthy or for any other reason. This is a realistic strategy for the recovery of skills, selection of the right job, and overcoming the resume problem. One year, three years or 10 years of a career … Read more

Read More

Best Career Options After Class 12 for Average Students in 2026

There’s no need to score 95% or achieve a JEE/NEET rank. You don’t need to score 95% or rank in JEE/NEET to build a solid career. A candid and pragmatic guide to the routes that actually work for students who have an average mark and what to do when faced with the options. ​ If … Read more

Read More

Coaching vs Self-Study: Which is Best in 2026 for Competitive Exams?

AI tools, online platforms that are much cheaper than coaching centres and the changing idea of what “structure” even means have upended this argument more in the past two years than in the decade preceding it. Here’s what is really the case for 2026 – and what has actually stayed the same. If you look … Read more

Read More

Benefits of Using Our NCERT Solutions for Class 12 Biology

When it comes to excelling in your studies, having a well-structured study guide can make a huge difference. Our NCERT Solutions for Class 12 Biology provide you with a comprehensive, easy-to-understand, and exam-focused resource that is specifically tailored to help you maximize your potential. Here are some of the key benefits of using our NCERT solutions for effective learning and high scores:

NCERT Solutions for Effective Exam Preparation

Preparing for exams requires more than just reading through textbooks. It demands a structured approach to understanding concepts, solving problems, and revising thoroughly. Here’s how our NCERT solutions can enhance your exam preparation:

  • Clear Understanding of Concepts: Our NCERT solutions are designed to break down complex topics into simple, understandable language, making it easier for students to grasp essential concepts in Biology. This helps in building a solid foundation for each chapter, which is crucial for scoring high marks.
  • Step-by-Step Solutions: Each solution is presented in a detailed, step-by-step manner. This approach not only helps you understand how to reach the answer but also equips you with the right techniques to tackle similar questions in exams.
  • Access to Important Questions: We provide a curated list of important questions and commonly asked questions in exams. By practicing these questions, you can familiarize yourself with the types of problems that are likely to appear in the exams and gain confidence in answering them.
  • Quick Revision Tool: Our NCERT solutions serve as an excellent tool for last-minute revision. The solutions cover all key points, definitions, and explanations, ensuring that you have everything you need to quickly review before exams.

Importance of Structured Answers for Scoring Higher Marks

In exams, it's not just about getting the right answer—it's also about presenting it in a well-structured and logical way. Our NCERT solutions for Class 12 Biology are designed to guide you on how to write answers that are organized and effective for scoring high marks.

  • Precise and Concise Answers: Our solutions are crafted to provide answers that are to the point, without unnecessary elaboration. This ensures that you don't waste time during exams and focus on delivering accurate answers that examiners appreciate.
  • Step-Wise Marks Distribution: We understand that exams often allot marks based on specific steps or points. Our NCERT solutions break down each answer into structured steps to ensure you cover all essential points required for full marks.
  • Improved Presentation Skills: By following the format of our NCERT solutions, you learn how to present your answers in a systematic and logical manner. This helps in making your answers easy to read and allows the examiner to quickly identify key points, resulting in better scores.
  • Alignment with NCERT Guidelines: Since exams are often set in alignment with NCERT guidelines, our solutions are tailored to follow the exact format and language that is expected in exams. This can improve your chances of scoring higher by meeting the examiner's expectations.
Keep learning

Discover More on SaralStudy

Explore all articles